Piltdown Hoax

1. Early Human fossils, also known as "The Piltdown Man" were found in England by Charles Dawson. The Piltdown Man was supposed to be the missing connection between apes and humans. Not only scientist were astonished by this finding, but a man named Arthur Keith was also using the Piltdown Man to prove the evolution theory in humans; but it was later discovered that Piltdown Man was in fact a fluke! This was found out by new technology used in World War 2 which helped discover actual dates when fossils were made by measuring fluorine content in the fossil. The test didn't match up and was proved false in the year 1953. The teeth however were made to look like a humans, but they were from an orangutan. 

2. Humans are not perfect and have many faults. In this issue, there were no fossils and the man who found them wanted to be known for his finding rather than for scientific purposes.  He wanted to be remembered and he got what he wanted, but instead of being remembered for changing science, he's remembered for being a phony. 

3. Some positive aspects from scientific process would be allowing tests and questions to doubted theories/experiments. It's not only to question ideas, but also to look for even better and more improved answers. The method used to test the Plitdown Man with the Florine was a perfect example of a scientific process. They tested the subject and were able to conclude that it was false. Also a test on the teeth were shown that it came from an orangutan; therefore that positive aspects of the scientific process were able to find the true discovery of the Plitdown Man. 

4. I find it impossible to remove the human factor in science because we as humans mess up and mistakes will come up. Science isn't science unless there are mistakes made. What makes the human factor so great is that it causes curiosity and makes us want to find or correct previous mistakes to further our theory. For Piltdown fossils, they were faked and proved false by human factors. If we just accepted what was given to us, we wouldn't progress in scientific, or any type of study. It may be possible to remove the human factor from science but i don't know why anyone would want too. Mistakes is what makes science move forward. 

5. A life lesson learned I would take into consideration from the Piltdown Man would be to always try and correct yourself so you can progress further into the future. If you do not take false actions into consideration, then you won't be able to surpass failures and instead just mask it. There will always be mistakes and humans are not perfect and we have many faults. Fix up any mistake possible and you will achieve many goals!

Comparing Primates

Lemurs :

Lemurs live in the tropical rain forests of Madagascar. They use their hands and legs to climb trees. Their locomotor pattern is found in their legs, which is used for leaping. Lemurs find it hard to travel through ground by walking, so a good majority hop from place to place. This trait has been influenced by their environments and was carried on from ancestors of lemurs and since they found walking trough land very difficult.

Spider Monkeys: 

The spider monkeys live in tropical rain forests of Central/South America. Their locomotor trait is their long arms and gripping tails which help them move from branch to branch (brachiating). Since they travel by tree so often, it's unnecessary for Spider-Monkeys to use their thumbs often because of their gripping tail. The lack of thumbs is a result of adaption to the environment. These traits show that the adaption to the environment had an important influence on the species.

Baboons: 

Baboons live in Africa/Arabia and live in a savannah like region. They are the largest monkeys and do not have tails. These animals do not have gripping tails, but they are able proceed up trees to rest. Their locomotor trait is quadruple walking, or walking on all fours. They are very adaptable to a majority of environments because of their locomotive trait. The baboon travels by foot most of the time; this being influenced by the savannas and which is why they do not need to swing from tree to tree often.

Gibbon:

Gibbons are found in South-East Asia. They live in the trees and swing to each tree which gives them great shoulder strength and long arms. Long arms resulted in the adaption to the environment of locomotion of swinging from branch to branch, or called  brachiating. 

They adapt to living in trees because of their long arms which enables them better to live in the trees. Its traits have been influenced by environmental adaption because since they are on trees so often, their fingers are curved to give a strong grip which helps them swing well.

Chimpanzee:

Chimpanzees are located in Central/South Africa and are the closest related to the humans. The chimpanzee lives in the forest, rainforest and savanna. They have a dense body and have no tail. Chimpanzees locomotor patterns is known to move on all fours both on ground and in the trees.  Chimps often use their knuckles to support when they walk, which gives them the name "knuckle-walker." This locomotor pattern is primarily due to the fact that chimpanzees arm length is longer than their legs, which makes them walk on the soles of their feet and the knuckles on their hands.from tree to tree. 

Summary:  Due to locomotor traits, the environment each one of these primates are located in both physical and movement traits. Primates that tend to live in the savannah regions which cover more ground forms the primate to walk on all fours, leaving them with longer front arms and short back legs. This adaptation causes these primates to be much faster on ground, and not as agile as in trees. While primates that live in the rainforest often have tails and long arms to help support them as they swing from branch to branch. These locomotor traits are all caused on locations each of these primates are set in. A question that occurred to me as I started this blog post was: If environment is such a big impact on each primates locomotor pattern, would they be able to adapt if they're put in a different environment? And if they do adapt, how would their physical traits come to appear?

Homologous and Analogous Animals

1. Homologous - Human & Whale

     The human and whale both share a common ancestry trait such as the structure of limbs in the vertebrate.  Humans as we know, live on land, while whales dwell in the depths of the seas.  The limbs on the whale and human are built on the same structure, but are switched around in different areas to support the living environment they're selected into.  A common ancestor from a whale and human would be the Ambulocetus, which also had a similar structure of limbs. There is no analogous similarity between a whales fin and a humans hand due to the different uses of them, but the similar structure of the limbs and vertebrae  is what makes humans and whales homologous.  

 2. Analogous - Owl and Butterfly

      The Owl and Butterfly however do not share an ancestry trait, but they both are given wings to be able to fly.  The anatomy of an owl's wings are structured into the bird family and leans towards the ancestry of humans because how the limbs are formed.  The structure of a butterflies wings are different than an owls anatomy, but share the same flying ability as the owl as well.  The ancestor of the owl is the Archaeopteryx and the ancestor of the butterfly is the Longhorn Caddis.  Both ancestors were gifted with flight, giving these two an analogous trait still.

DNA Decipher

CGTACTACCAACCGAACGGCAGCTTAAATATATTGATCTGTCA